
BioPHP implements some light tools for manipulating genomic data

dev-master 2021-07-23 19:02 UTC

This package is auto-updated.

Last update: 2022-06-23 21:01:44 UTC


BioPHP implements a selection of simple tools for manipulating genomic data. It aims to build tools for basic RNA, DNA, and protein manipulation.'s fork is designed for biotorrents/gazelle and is heavily inspired by TimothyStiles/poly.

Simple Usage (to be revised)

Find Reverse Complement

$BioPHP = new BioPHP();
$result = $BioPHP->reverse('ATGAAAGCATC');
$result = $BioPHP->complement($result);
//prints TTTCAT

Calculate GC Content

$BioPHP = new BioPHP();
echo $BioPHP->gcContent('ATGAAAGCATC', 4)."\n";
//prints 36.3636

Count Point Mutations Between Two Sequences

$BioPHP = new BioPHP();
//prints 4

Translate DNA Sequence to Amino Acid Sequence

$BioPHP = new BioPHP();
echo $BioPHP->translateDna('CTGATGATGGGAGGAAATTTCAGA')."\n";
//prints LMMGGNFR

Calculate Monoisotopic Mass

$BioPHP = new BioPHP();
$proteinSequence = $BioPHP->translateDna('CTGATGATGGGAGGAAATTTCAGA')."\n";
echo $BioPHP->calcMonoIsotopicMass($proteinSequence)."\n\n";
//prints 906.42041

Finding a Motif in DNA

$BioPHP = new BioPHP();
echo $BioPHP->findMotifDNA('ATAT', 'GTATATCTATATGGCCATAT')."\n";
//prints 3 9 17

Get Reading Frames

$BioPHP = new BioPHP();
print_r( $BioPHP->getReadingFrames('GTATATCTATATGGCCATAT') );

* returns array containing...

//Protip: To get all 6 reading frames. Use the reverse and complement methods, then pass the result to getReadingFrames()

Find most common likely ancestor

$fastaSequence = "
>Sequence 1
>Sequence 2
>Sequence 3

$BioPHP = new BioPHP();
$fastaArray = $BioPHP->readFasta($fastaSequence); //read and parse the sequences
echo $BioPHP->mostLikelyCommonAncestor($fastaArray)."\n";

//prints ATGCAACT

Get a fasta result from Uniprot and calculate isotpoic mass

$BioPHP = new BioPHP();
$uniprotFasta =  $BioPHP->getUniprotFastaByID("B5ZC00"); //returns the result from Uniprot as a string
$fastaArray = $BioPHP->readFasta($uniprotFasta); //parses the response
echo $BioPHP->calcMonoIsotopicMass($fastaArray[0]['sequence'])."\n";

//prints 55319.0636

Find protein motif using a variable "shorthand" motif search

$BioPHP = new BioPHP();
$results = $BioPHP->findMotifProtein("N{P}[ST]{P}","B5ZC00");

* returns array containing...
    [0] => 85
    [1] => 118
    [2] => 142
    [3] => 306
    [4] => 395

//Notes: The second parameter expects a protein access ID string used to lookup the full sequence via UniProt.

Finding a shared motif

This task can be very CPU intensive. Using PHP 7, this method benchmarked faster than Python! Runtime results were about 1 second with a collection of 100 DNA strings of length 1 kbp each.

>Sequence 1
>Sequence 2
>Sequence 3

$BioPHP = new BioPHP();
$fastaArray = $BioPHP->readFasta($fasta);
$result = $BioPHP->findLongestSharedMotif($fastaArray);
echo $result."\n";
//prints TA

Find open reading frames from DNA sequnce

$Sequence = ">Test DNA Sequence

$BioPHP = new BioPHP();
$results = $BioPHP->printORFProteins($Sequence);

* Returns the following array
    [0] => MP


Locating restriction sites between length of 4 and 12

$BioPHP = new BioPHP();
$results = $BioPHP->findRestrictionSites("TCAATGCATGCGGGTCTATATGCAT", 4, 12);
//returns an array containing postion and length of restrictions

Inferring mRNA from Protein - calculates total different RNA strings from which the protein can be translated

Note: This method requires the use of the PHP Math Big Integer package which is a composer dependency of this project.

$BioPHP = new BioPHP();
echo $result."\n";
//prints 884608